rRNA carries the instructions for translation.

1. True
2. False

Proteins are made up of ______ different kinds of amino acid.

1. 4
2. hundreds of
3. 46
4. 20

In eukaryotic cells, sequences of mRNA that are NOT removed before translation are called  

1. introns
2. anticodons
3. exons
4. terminators

What is the anticodon for GUU?

1. CAA
2. TAG
3. UAG
4. None of the above

Your entire genetic code is analogous to ________________.

1. an electric motor
2. a cook
3. a recipe
4. a cookbook

The step of translation in which the first amino acids joins the ribosome and mRNA is  

1. mitosis
2. elongation
3. initiation
4. termination

A group of genes, a promoter, and an operator that control transcription are called a(n

1. chromosome. 
2. translational unit.
3. ribosome.
4. envelope. 
5. operon.

What amino acid code does ACU code for?

1. Serine
2. Proline
3. both Serine and Proline
4. Arginine
5. Threonine
6. Leucine

In a “nonsense” mutation  

1. the codon that mutates does not cause a change in the amino acid specified. 
2. the codon that mutates causes a change in the amino acid specified. 
3. the codon that mutates causes a stop codon to occur instead of the placement of an amino acid. 
4. the mutation is not in DNA.

How many codons are in the mRNA sequence GGAAUGAAACAGGAACCCAAA?  

1. 4
2. 7
3. 18
4. 10

All mutations involve some kind of change in the genetic code.

1. True
2. False

All mutations are harmful

1. True
2. False

Many viruses are inhibited by antibiotics

1. True
2. False

DNA is packaged in units called

1. centrosomes
2. chromosomes
3. histones
4. centromeres

Bacteria go through a form of cell division called _____________.

1. Cytokinesis
2. binary fusion
3. binary fission
4. None of the above

The majority of a cell’s life cycle is spent in

1. G2 phase
2. Interphase
3. Mitosis
4. Cytokinesis

In mitosis of animal cells, cytokinesis involves the

1. formation of the membranes
2. the formation of a cell plate
3. the formation of a cleavage furrow
4. the splitting of nucleus

Which phase of the cell cycle directly precedes mitosis?

1. G1 phase
2. G2 phase
3. S phase
4. Cytokinesis

When a cell first enters into cell division, the DNA in its nucleus

1. unravels to form chromatin
2. condenses to form thick, ribbonlike chromosomes
3. completely disintegrates
4. is copied

When, during mitosis, do we first see the functioning centrosomes?

1. Metaphase
2. Anaphase
3. Telophase
4. Prophase

Which phase of mitosis occurs second in the change of events?

1. Anaphase
2. Telophase
3. Prophase
4. Metaphase

Which phase of mitosis involves the forming of the nuclear membrane?

1. Metaphase
2. Prophase
3. Telophase
4. Anaphase

In some fungi and slime molds, mitosis may occur without cytokinesis. What would you expect to find in these species?

1. cells that don’t contain nuclei
2. cells that contain multiple nuclei
3. DNA that never condenses into visible chromosomes
4. nuclei that never enter interphase

During cytokinesis of a plant cell, the cell divides by forming a cleavage furrow.

1. True
2. False

The chemotherapy drug taxol inhibits microtubule function. A cell treated with taxol would become stuck in which phase?  

1. prophase
2. telophase
3. anaphase
4. telophase

Cancer is believed to be associated with a failure of the cell cycle.

1. True
2. False