Module 4 Exam
What is the main function of DNA?
- to encode proteins
- to produce ATP
- to speed up cell reactions
- to provide structural support to the cell
- All of the above
RNA is composed of building blocks called
- amino acids
- monosaccharides
- phospholipids
- disaccharides
- nucleotides
In Transcription, DNA is copied to produce
- RNA polymerase
- transfer RNA
- a ribosome
- messenger RNA
In Translation, what brings in new amino acids?
- the ribosome
- the transfer RNA
- the amino acids
- RNA polymerase
RNA differs from DNA in many ways, including
- DNA contains deoxyribose and RNA contains ribose
- DNA contains thymine and RNA contains uracil instead of thymine
- DNA is double stranded and RNA is single stranded.
- RNA can catalyze some chemical reactions and DNA cannot.
- All of the above are correct
If the DNA template strand has the following sequence, what would be the nucleotide sequence of the complementary RNA molecule produced in transcription? Template strand: GACCTTA
- AGTCTT
- UCAGAA
- TCAGAA
- CUGGAAU
rRNA carries the instructions for translation.
- True
- False
Proteins are made up of ______ different kinds of amino acid.
- 4
- hundreds of
- 46
- 20
In eukaryotic cells, sequences of mRNA that are NOT removed before translation are called
- introns
- anticodons
- exons
- terminators
What is the anticodon for GUU?
- CAA
- TAG
- UAG
- None of the above
Your entire genetic code is analogous to ________________.
- an electric motor
- a cook
- a recipe
- a cookbook
The step of translation in which the first amino acids joins the ribosome and mRNA is
- mitosis
- elongation
- initiation
- termination
A group of genes, a promoter, and an operator that control transcription are called a(n
- chromosome.
- translational unit.
- ribosome.
- envelope.
- operon.
What amino acid code does ACU code for?

- Serine
- Proline
- both Serine and Proline
- Arginine
- Threonine
- Leucine
In a “nonsense” mutation
- the codon that mutates does not cause a change in the amino acid specified.
- the codon that mutates causes a change in the amino acid specified.
- the codon that mutates causes a stop codon to occur instead of the placement of an amino acid.
- the mutation is not in DNA.
How many codons are in the mRNA sequence GGAAUGAAACAGGAACCCAAA?
- 4
- 7
- 18
- 10
All mutations involve some kind of change in the genetic code.
- True
- False
All mutations are harmful
- True
- False
Many viruses are inhibited by antibiotics
- True
- False
DNA is packaged in units called
- centrosomes
- chromosomes
- histones
- centromeres
Bacteria go through a form of cell division called _____________.
- Cytokinesis
- binary fusion
- binary fission
- None of the above
The majority of a cell’s life cycle is spent in
- G2 phase
- Interphase
- Mitosis
- Cytokinesis
In mitosis of animal cells, cytokinesis involves the
- formation of the membranes
- the formation of a cell plate
- the formation of a cleavage furrow
- the splitting of nucleus
Which phase of the cell cycle directly precedes mitosis?
- G1 phase
- G2 phase
- S phase
- Cytokinesis
When a cell first enters into cell division, the DNA in its nucleus
- unravels to form chromatin
- condenses to form thick, ribbonlike chromosomes
- completely disintegrates
- is copied
When, during mitosis, do we first see the functioning centrosomes?
- Metaphase
- Anaphase
- Telophase
- Prophase
Which phase of mitosis occurs second in the change of events?
- Anaphase
- Telophase
- Prophase
- Metaphase
Which phase of mitosis involves the forming of the nuclear membrane?
- Metaphase
- Prophase
- Telophase
- Anaphase
In some fungi and slime molds, mitosis may occur without cytokinesis. What would you expect to find in these species?
- cells that don’t contain nuclei
- cells that contain multiple nuclei
- DNA that never condenses into visible chromosomes
- nuclei that never enter interphase
During cytokinesis of a plant cell, the cell divides by forming a cleavage furrow.
- True
- False
The chemotherapy drug taxol inhibits microtubule function. A cell treated with taxol would become stuck in which phase?
- prophase
- telophase
- anaphase
- telophase
Cancer is believed to be associated with a failure of the cell cycle.
- True
- False
Biology 1 – Life Sciences
Thanks to our users for contributing their review materials. All the materials you see are submitted by our users to help other users prepare for their own exams. If you need help with your online classes, contact us for quote and queries.
