Register
Client Area

iWriteGigs

support@iwritegigs.com
Facebook-f
Register
Client Area

Fresh Grad Lands Job as Real Estate Agent With Help from Professional Writers

People go to websites to get the information they desperately need.  They could be looking for an answer to a nagging question.  They might be looking for help in completing an important task.  For recent graduates, they might be looking for ways on how to prepare a comprehensive resume that can capture the attention of the hiring manager

Manush is a recent graduate from a prestigious university in California who is looking for a job opportunity as a real estate agent.  While he already has samples provided by his friends, he still feels something lacking in his resume.  Specifically, the he believes that his professional objective statement lacks focus and clarity. 

Thus, he sought our assistance in improving editing and proofreading his resume. 

In revising his resume, iwritegigs highlighted his soft skills such as his communication skills, ability to negotiate, patience and tactfulness.  In the professional experience part, our team added some skills that are aligned with the position he is applying for.

When he was chosen for the real estate agent position, he sent us this thank you note:

“Kudos to the team for a job well done.  I am sincerely appreciative of the time and effort you gave on my resume.  You did not only help me land the job I had always been dreaming of but you also made me realize how important adding those specific keywords to my resume!  Cheers!

Manush’s story shows the importance of using powerful keywords to his resume in landing the job he wanted.

Test 2 Chp 6-10

Navigation   » List of Schools  »  Los Angeles Valley College  »  Biology  »  Biology 003 – Introduction to Biology  »  Fall 2022  »  Test 2 Chp 6-10

Need help with your exam preparation?


Existing Quiz Clients Login here

Below are the questions for the exam with the choices of answers:

Question #1
What is the complimentary mRNA for this piece of DNA?
3′ ATCGTACTGCATATGAAC 5′             
A  5′ UAGCAUGACGUAUACUUG 3′
B  3′ UAGCAUGAAGUAUACUUG 5′
C  5′ UAGCAAGACGUAUACAUG 3′
D  5′ GCGTACGCATTCATGCCGACTCAA 3′
Question #2
Which is NOT apart of RNA processing.
A  A poly-A tail is added to the mRNA
B  RNA polymerase opens up DNA
C  Exons are spliced togther to make mRNA
D  Interons are removed from the RNA
E  A cap is added to the start of the mRNA
Question #3
Transcription occurs in the cytoplasm of the cell.
A  False
B  True
Question #4
Match the term with the example. Sickle cell and malaria resistance both show up
A  Pleiotopy
B  Polygenic
C  Codominant
D  Pure dominance
Question #5
Match the term with the example. A freckled woman and a non freckled man have a freckled baby
A  Incompletely dominant
B  Pure dominance
C  Codominant
D  Polygenic
Question #6
Match the term with the example. A red flower and a white flower are bred to have a white and red speckled offpspring
A  Incompletely dominant
B  Pleiotopy
C  Codominant
D  Polygenic
Question #7
Match the term with the example. Black chicken and a white chicken have a gray chicken offspring.
A  Incompletely dominant
B  Polygenic
C  Codominant
D  Pure dominance
Question #8
The greatest amount of ATP is produced during the glycolysis step of cellular respiration.
A  True
B  False
Question #9
Enzyme inhibitors can prevent a reaction from occurring by binding to the enzyme active site.
A  False
B  True
Question #10
Enzymes act as catalysts by raising the activation energy needed for a chemical reaction to proceed.
A  False
B  True
Question #11
ABO blood types are considered incompletely dominant.
A  False
B  True
Question #12
Lactic acid is a byproduct of fermentation that occurs in yeast to make ethyl alcohol.
A  False
B  True
Question #13
Cytokinesis is considered a part of Meiosis but not Mitosis.
A  False
B  True
Question #14
Fermentation, glycolysis and the Krebs cycle produce 2 ATP each.
A  True
B  False
Question #15
Which of the following lists the reactions of cellular respiration in the correct order?
A  electron transport chain; glycolysis; Krebs (citric acid) cycle; acetyl-coA production
B  glycolysis; acetyl-coA production; electron transport chain; Krebs (citric acid) cycle
C  acetyl-coA production; Krebs (citric acid) cycle; electron transport chain; glycolysis
D  glycolysis; acetyl-coA production; Krebs (citric acid) cycle; electron transport chain
E  Krebs (citric acid) cycle; glycolysis; acetyl-coA production; electron transport chain
Question #16
Sex linked traits are shown more often when on in the _____________.
A  Male’s Y chromosome
B  Mother’s X chromosomes
C  Male’s X chromosome
Question #17
Which of the following crosses would produce an offspring that is homozygous recessive?
A  YY x Yy
B  yy x yy
C  YY x YY
D  YY x yy
Question #18
What kind of mutation is this?
old- ATTCGCATACG
new -ATTCGGATACG
A  Substitution
B  No mutation
C  Insertion
D  Deletion
Question #19
Osmosis:
A  uses ATP as an energy source
B  is the passive transposrt of water across a membrane
C  is the passive transport of solutes across a membrane
D  Can transport molecules from low concentartion to high concentration
Question #20
Which of the following is NOT true about Mitosis?
A  It happens in somatic cells
B  It produces 2 daughter cells
C  It seperates sister chromatids
D  It consists of Interphase, metaphase, anaphase and telophase
Question #21
If you bred a white chicken and a black chicken together and they were Codominant traits, the offspring would be what color?
A  White
B  Black and White speckled
C  Black
D  Grey
Question #22
Skin color and height are examples are
A  Mendelian genetics
B  Pleiotropy
C  Codominance
D  Polygenic
Question #23
The light reactions of photosynthesis occurs in the
A  Cytokinesis
B  Pleiotropy
C  Polygenic
D  Thylakoids
Question #24
Fermentation reactions generaly happen under conditions of:
A  low oxygen concentrations
B  low glucose levels
C  high oxygen concentrations
D  extreme drought
E  extremely high temperautres
Question #25
Which of the following are products of the light reactions that are then used in the Calvin Cycle?
A  ATP and Glucose
B  NADPH and ATP
C  Glucose and Oxygen
D  NAD+ and ADP
Play Video

“Many thanks for the killer business plan we worked on.  You guys are angels sent to me.  Congratulations to the team for a job well done. I hope you help more entrepreneurs like me grow their businesses.  I will surely bring some clients your way!”

Christian S.
SaaS Business Founder

“Thanks for all your help in bringing my website back to life. You are life savers.  With your help, I now have a more thorough understanding of my target audience.  I wish I had met your earlier, I could have saved tons of work hours.”

Tyra
Blogger

“We can never be thankful enough iwritegigs.com for helping us with our business.  We have been hesitating for years hiring a professional writer thinking it was only an extra cost to our business.  It has been a pleasure working with you.” 

Linda
Start Up Founder

“Kudos to the team for a job well done.  I am sincerely appreciative of the time and effort you gave on my resume.  You did not only help me land the job I had always been dreaming of but you also made me realize how important adding those specific keywords to my resume!  Cheers!

Manush
Fresh Graduate
We accept payment

Terms of Service
Copyright © 2021 iWriteGigs
ElitePro Writing Business Solutions LLC

30 N Gould St Ste R, Sheridan, WY 82801 

Call Us at 1-(323) 410-1787
Send us sms at 1-(323) 410-1787

17 Mabini St. Barangay San Diego Zone 2 Tayabas City, Philippines